sb:cb1067

Ensembl ID:
ENSDARG00000016483
ZFIN ID:
ZDB-GENE-040108-10
Human Orthologue:
BAIAP2L2
Human Description:
BAI1-associated protein 2-like 2 [Source:HGNC Symbol;Acc:26203]
Mouse Orthologue:
Baiap2l2
Mouse Description:
BAI1-associated protein 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:2652819]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26057 Nonsense Mutation detected in F1 DNA During 2018
sa33164 Essential Splice Site Mutation detected in F1 DNA During 2018
sa26056 Essential Splice Site Mutation detected in F1 DNA During 2018
sa26055 Nonsense Mutation detected in F1 DNA During 2018
sa38386 Nonsense Mutation detected in F1 DNA During 2018
sa17195 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Nonsense 4 419 1 14
Genomic Location (Zv9):
Chromosome 3 (position 24747671)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24325882
GRCz11 3 24456430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGTTTATTTGTTTGTTGTGCCACAGTGACAGATCAAGATGTCAGGA[C/T]AAAACAGTGATCAACTGCATCGCACCACTCTGGGCATTTATACGGTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Essential Splice Site 93 419 4 14
Genomic Location (Zv9):
Chromosome 3 (position 24742504)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24320715
GRCz11 3 24451263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATGTCAGACAGTCAGAGGAGACTCACCAACGAGCTGGAGGGAGTGG[T/A]CTGTTATTCATCCTTGACTATCGATCCATCGTTTGATATCTTCTGTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Essential Splice Site 117 419 5 14
Genomic Location (Zv9):
Chromosome 3 (position 24742305)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24320516
GRCz11 3 24451064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAAGAGATGGACAACAATGTCAGATTGGATAAAGATTACATATCGG[T/A]GAGTTTTATAGAGGCAACATCAGCCCTCCTGTGAATAAATATTTGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Nonsense 137 419 6 14
Genomic Location (Zv9):
Chromosome 3 (position 24740010)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24318221
GRCz11 3 24448769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGATATGAGATGGAGGTGAGAAACCAGGCAACAGCACTGGAGAGA[C/T]AGATGAGGCGAGGAGTACCGCAGGTCAGAGCACGTTTATCAATGTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Nonsense 168 419 7 14
Genomic Location (Zv9):
Chromosome 3 (position 24739392)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24317603
GRCz11 3 24448151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCAAGGAGTGTCAGAAGGAGGCGTTAAAGGAGGAGGAAAGGCGATA[T/A]CGATTCCTGGCGGAAAAACACTGTGGGCTGACTCAGTCTATTGCTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024480 Essential Splice Site 222 419 8 14
Genomic Location (Zv9):
Chromosome 3 (position 24738651)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24316862
GRCz11 3 24447410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAGAGAATCMCGTTCACGCACTCCTTCAMGGCTGGAGGACAACATTG[T/A]GMGAAATAGTAMCATTTAACCCNAAAAACCCTTTTGCCCTAAATAATGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link