oaz2

Ensembl ID:
ENSDARG00000016476
ZFIN IDs:
ZDB-GENE-020731-5, ZDB-GENE-020731-5
Description:
Ornithine decarboxylase antizyme 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9YI97]
Human Orthologue:
OAZ1
Human Description:
ornithine decarboxylase antizyme 1 [Source:HGNC Symbol;Acc:8095]
Mouse Orthologue:
Oaz1
Mouse Description:
ornithine decarboxylase antizyme 1 Gene [Source:MGI Symbol;Acc:MGI:109433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29485 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007748 Missense 174 217 5 6
ENSDART00000122627   None 60 4 6
Genomic Location (Zv9):
Chromosome 21 (position 825329)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 706109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGAAGGTGGTCAGTGTGTTTGTCTGCTTCTACAAGAACAGGGAGGAT[C/A]GTGGTGAGTAAAGCACACATCAACACACACCACTGCAGTTTATTAGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link