galcb

Ensembl ID:
ENSDARG00000016474
ZFIN ID:
ZDB-GENE-040426-2115
Description:
galactosylceramidase [Source:RefSeq peptide;Acc:NP_998276]
Human Orthologue:
GALC
Human Description:
galactosylceramidase [Source:HGNC Symbol;Acc:4115]
Mouse Orthologue:
Galc
Mouse Description:
galactosylceramidase Gene [Source:MGI Symbol;Acc:MGI:95636]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17897 Nonsense Available for shipment Available now
sa16336 Nonsense Available for shipment Available now
sa23042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028044 Nonsense 56 664 2 17
Genomic Location:
Chromosome 17 (position 18727920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGTTATATACTTGTTTTCCACAGGCGACATCGCGTTTACTTGTCAATTA[T/A]GAGGAGCCATATCRGAGTCAGATACTAGACTACCTGTTTAAGGTCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028044 Nonsense 78 664 3 17
Genomic Location:
Chromosome 17 (position 18727759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTMTATGCATGTAAATGTGTATTTAACAGCCAAAATTTGGAGCCTCCTTA[C/T]AAATCCTAAAGGTTGAAATCGGAGGYGATGCTCAGACYACAGGTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028044 Nonsense 111 664 4 17
Genomic Location:
Chromosome 17 (position 18726407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCCTCACACATGCACTATGAAGATGATGAGAATTATTTTAGAGGGTA[T/A]GAATGGTGGCTAATGGTGGAAGCCAAGAAGAGGAATCCAAACATCACCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s7aub5i4