si:ch211-89p3.3

Ensembl ID:
ENSDARG00000016464
ZFIN IDs:
ZDB-GENE-041014-372, ZDB-GENE-080219-17
Description:
serine/threonine-protein kinase MRCK alpha [Source:RefSeq peptide;Acc:NP_001038559]
Human Orthologue:
CDC42BPA
Human Description:
CDC42 binding protein kinase alpha (DMPK-like) [Source:HGNC Symbol;Acc:1737]
Mouse Orthologue:
Cdc42bpa
Mouse Description:
CDC42 binding protein kinase alpha Gene [Source:MGI Symbol;Acc:MGI:2441841]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23762 Nonsense Available for shipment Available now
sa37106 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37107 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37108 Nonsense Mutation detected in F1 DNA During 2017
sa8673 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Nonsense 519 1716 12 37
ENSDART00000113773 Nonsense 519 1768 12 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35186847)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35259360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACTCTGGTCAGATGGAGCAGCAGTTGGAGAACGCCAGCACAGCTAGA[A/T]GAGACCTGGAAGACTCGTCCAAGGTCGTCAGGAACTTAGAGAAACAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Essential Splice Site 784 1716 16 37
ENSDART00000113773 Essential Splice Site 784 1768 16 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35195912)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35268425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCATCTGACAGACGAAAACAAGAAGCTGAGTGCCGAAGTGGAGAAGG[T/A]AAGATCTCTATCGCTTTCAACAACACATGTGCTCATGATATTCATTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Essential Splice Site 967 1716 21 37
ENSDART00000113773 Essential Splice Site 967 1768 21 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35203071)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35275584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTGGCTTTCCTCAATGCGCCCACTTCTGCACTGGATCAGTTTGAT[G/T]TAAGTTTGAGATGCCAGGTGTTGTTCATGAGCACATCTGCATAGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Nonsense 1270 1716 29 37
ENSDART00000113773 Nonsense 1322 1768 31 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35215651)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35288164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCATCATGTAGAACTGATGCCCACGGAGCACATACTGGCCGTCATCT[C/A]GGGCAGGAACCGACAAGTATGTCTGGTCTCCATGGCGGGTCTCGACGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Essential Splice Site 1341 1716 29 37
ENSDART00000113773 Essential Splice Site 1393 1768 31 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35215867)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35288380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAATTAACAAGAGCAAGTCACGACACTCCCATCTCGTGGACATACAAG[T/C]ACAGTCTCCAAAACCTCTTCCTTTYMGATCATACTRATGTGAAATCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040456 Nonsense 1605 1716 35 37
ENSDART00000113773 Nonsense 1657 1768 37 39
ENSDART00000114262   None 306 None 2
Genomic Location (Zv9):
Chromosome 20 (position 35222710)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35295223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGTGCTGGATTCAGCGGCTCCGTCAGCATCCCCTCCATTACAAAAMAY[A/T]GAGCAGARCCAGGGCGATCCATGAGCGCAAGCAGTGGCCTAGGAATGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link