irf9

Ensembl ID:
ENSDARG00000016457
ZFIN ID:
ZDB-GENE-040912-165
Description:
interferon regulatory factor 9 [Source:RefSeq peptide;Acc:NP_991273]
Human Orthologue:
IRF9
Human Description:
interferon regulatory factor 9 [Source:HGNC Symbol;Acc:6131]
Mouse Orthologue:
Irf9
Mouse Description:
interferon regulatory factor 9 Gene [Source:MGI Symbol;Acc:MGI:107587]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17117 Nonsense Available for shipment Available now
sa6239 Nonsense Mutation detected in F1 DNA During 2014
sa4457 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 112 394 4 10
ENSDART00000125220 Nonsense 112 280 3 10
ENSDART00000137757 Nonsense 112 428 4 10
Genomic Location:
Chromosome 12 (position 14394092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTCACAGAAAGGTCACAGCTGGATATTTCAGAACCCTACAAGGTGTA[T/A]CGCCTTGTACCACCAGAAGAACAAGGTAGTCAACATGTGCTACACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 346 394 8 10
ENSDART00000125220 None None 280 8 10
ENSDART00000137757 Nonsense 346 428 8 10
Genomic Location:
Chromosome 12 (position 14401896)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAGATCAGGCACGCCAACCCAGCTGTTTAACCGGGAGATATTTCAA[C/T]AAGGTAAGTGTTTCACAAGCATCTACAGTATTTAGMTTTATAAAACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4457
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 382 394 9 10
ENSDART00000125220 None None 280 9 10
ENSDART00000137757 None 381 428 9 10
Genomic Location:
Chromosome 12 (position 14409442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGGAGAGGAGCTCTTGGAGGRAGATAACATCTCTGATAAACACAT[C/A]ATCATTAAGGTAAATGCGTAATTGATGTACATATATAGATCATTACTACR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/49t2ser1