esr2a

Ensembl ID:
ENSDARG00000016454
ZFIN ID:
ZDB-GENE-030116-2
Description:
estrogen receptor 2a [Source:RefSeq peptide;Acc:NP_851297]
Human Orthologue:
ESR2
Human Description:
estrogen receptor 2 (ER beta) [Source:HGNC Symbol;Acc:3468]
Mouse Orthologue:
Esr2
Mouse Description:
estrogen receptor 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:109392]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37010 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25133 Nonsense Mutation detected in F1 DNA During 2016
sa16405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643   None 553 None 10
ENSDART00000129589   None 551 None 12
ENSDART00000131069 Essential Splice Site None 553 2 11
Genomic Location (Zv9):
Chromosome 20 (position 21667301)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21695468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTATCCACTTTATCACATCATCCTTTTGTGCTTCTGTCATTCTGC[A/T]GGTGCTTGTTCTTGTTCTGTGCTCAGGGTATGTTTTGGCCGCTTGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 119 553 2 10
ENSDART00000129589 Nonsense 117 551 4 12
ENSDART00000131069 Nonsense 119 553 3 11
Genomic Location (Zv9):
Chromosome 20 (position 21673532)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21701699
KASP Assay ID:
554-7852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAACAACAGAGTCGACTTCAACAGAACCATGCTACTAGTGGGACTT[G/A]GACCGAACATACACCACATGATCATGTTGAAGAGGAAAACAGGTAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 411 553 7 10
ENSDART00000129589 Nonsense 409 551 9 12
ENSDART00000131069 Nonsense 411 553 8 11
Genomic Location (Zv9):
Chromosome 20 (position 21697722)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21725889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGATATGCTGCTGGCAGCCACGTCCAGATTCAGAGAGYTGAAGTTA[C/T]AGAGAGAAGAGTACGTGTGTCTCAAAGCCATGATCCTCCTGAACTCCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link