esr2a

Ensembl ID:
ENSDARG00000016454
ZFIN ID:
ZDB-GENE-030116-2
Description:
estrogen receptor 2a [Source:RefSeq peptide;Acc:NP_851297]
Human Orthologue:
ESR2
Human Description:
estrogen receptor 2 (ER beta) [Source:HGNC Symbol;Acc:3468]
Mouse Orthologue:
Esr2
Mouse Description:
estrogen receptor 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:109392]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25133 Nonsense Mutation detected in F1 DNA During 2014
sa16405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 119 553 2 10
ENSDART00000129589 Nonsense 117 551 4 12
ENSDART00000131069 Nonsense 119 553 3 11
Genomic Location:
Chromosome 20 (position 21673532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAACAACAGAGTCGACTTCAACAGAACCATGCTACTAGTGGGACTT[G/A]GACCGAACATACACCACATGATCATGTTGAAGAGGAAAACAGGTAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 411 553 7 10
ENSDART00000129589 Nonsense 409 551 9 12
ENSDART00000131069 Nonsense 411 553 8 11
Genomic Location:
Chromosome 20 (position 21697722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGATATGCTGCTGGCAGCCACGTCCAGATTCAGAGAGYTGAAGTTA[C/T]AGAGAGAAGAGTACGTGTGTCTCAAAGCCATGATCCTCCTGAACTCCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c9jwcyk8