ythdf1

Ensembl ID:
ENSDARG00000016447
ZFIN ID:
ZDB-GENE-040426-2786
Description:
YTH domain family protein 1 [Source:RefSeq peptide;Acc:NP_997878]
Human Orthologue:
YTHDF1
Human Description:
YTH domain family, member 1 [Source:HGNC Symbol;Acc:15867]
Mouse Orthologue:
Ythdf1
Mouse Description:
YTH domain family 1 Gene [Source:MGI Symbol;Acc:MGI:1917431]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13414 Nonsense Available for shipment Available now
sa41192 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Nonsense 309 614 4 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23962681)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23088499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATTGCCACCYMACCACCACCACCAGCAGCAGCCTCMCCTCCACTCC[C/T]AGGGTCACCTTCCACCTCACCCTCATGGACTGCCACCCCCACCTCAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Nonsense 540 614 4 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23963374)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23089192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGCCCAACAGTCAGCTCAGGCACATCCGCCTGGAGAACAATGACAAC[A/T]AGCCCGTGACCAACTCGCGTGACACACAGGAGGTGCCTCTGGAAAAGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link