si:ch211-69k21.2

Ensembl ID:
ENSDARG00000016439
ZFIN ID:
ZDB-GENE-091116-69
Human Orthologue:
SLC7A1
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a1
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9642 Nonsense Available for shipment Available now
sa38799 Nonsense Mutation detected in F1 DNA During 2017
sa21734 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 27 610 1 11
ENSDART00000146370 Nonsense 27 652 2 12
Genomic Location (Zv9):
Chromosome 10 (position 24900196)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24499548
KASP Assay ID:
2260-3236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACAGCTGCTGAGAGTAAAGGTTGTAAACTGCAACTCAGAGGAATCR[C/T]GACTGTCCCGATGTCTGAACACTTTTGACCTGGTGGCTCTTGGTGTGGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 96 610 1 11
ENSDART00000146370 Nonsense 96 652 2 12
Genomic Location (Zv9):
Chromosome 10 (position 24900404)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24499756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGTCTCTGTTATGCAGAGTTTGGAGCCAGAGTGCCCAAAACAGGAT[C/A]AGCGTACCTGTACAGCTACGTGACTGTAGGAGAGCTGTGGGCCTTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Essential Splice Site 493 610 8 11
ENSDART00000146370 Essential Splice Site 503 652 9 12
Genomic Location (Zv9):
Chromosome 10 (position 24919606)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24518958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCAACCTGTCTGGATTCACCGTTAACATCTGCACCAGTCTGCTCGG[T/A]ATGAAATATTCAAGACAAACACTGCAAACAAAAATAAGTAATTAATAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link