FARP2

Ensembl ID:
ENSDARG00000016429
Description:
FERM, RhoGEF and pleckstrin domain protein 2 [Source:HGNC Symbol;Acc:16460]
Human Orthologue:
FARP2
Human Description:
FERM, RhoGEF and pleckstrin domain protein 2 [Source:HGNC Symbol;Acc:16460]
Mouse Orthologue:
Farp2
Mouse Description:
FERM, RhoGEF and pleckstrin domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385126]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40695 Nonsense Mutation detected in F1 DNA During 2016
sa18842 Nonsense Mutation detected in F1 DNA During 2016
sa3581 Nonsense Mutation detected in F1 DNA During 2016
sa15550 Nonsense Available for shipment Available now
sa40696 Nonsense Mutation detected in F1 DNA During 2016
sa38550 Essential Splice Site Mutation detected in F1 DNA During 2016
sa26745 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 162 1044 5 26
Genomic Location:
Chromosome 6 (position 26704527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTCTCTGCAGATAAAGAGGGATCTATTAGATGGCCGACTGAGCTG[T/A]ACAGAAAACACTGCTGCCCTGCTTGCCTCTCATTTGGTGCAATGTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 355 1044 10 26
ENSDART00000013400 Nonsense 355 1044 10 26
Genomic Location:
Chromosome 6 (position 26713270)
KASP Assay ID:
2259-7557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCATAAAACCTTATATTTCAATTTATATTTAACAGTGGGAGGACA[C/T]AGAAACAGCTTGTTGAGTATGTGAGGGACAGCGGGTTGAGAAGAACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 355 1044 10 26
ENSDART00000013400 Nonsense 355 1044 10 26
Genomic Location:
Chromosome 6 (position 26713270)
KASP Assay ID:
2259-7557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTCAKAAAACCTTAYATTTCAATTTATATTTAACAGTGGGAGGACA[C/T]AGAAACAGCTTGTTGAGTATGTGAGGGACAGCGGGTTRAGAAGAACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 382 1044 11 26
Genomic Location:
Chromosome 6 (position 26713480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWGTATTGATTATTCKATTTTTACAGGAGRAACAGTAAGATTCGCATGT[C/A]GAYGCGTTCCTTGGCTTCTGATGTGCCAAAACAGGTCAGCAGAGTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 529 1044 14 26
Genomic Location:
Chromosome 6 (position 26724668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAACTCATCAAAGAGTGGTTTTAAGTCTGCTTTCTTTTTTCAGAGATA[T/A]CCAACAGACAAAGCCTACTTCATTGCAAAAGAGATTCTGACAACAGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Essential Splice Site 708 1044 17 26
Genomic Location:
Chromosome 6 (position 26727051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTAAACATTATTCACCCCAGCACAGAGACTACGATGACTGCAAAG[G/A]TAGACCTTATTCACATAAATATCACATTTTTTTGTTCTGAAAATCTGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 948 1044 24 26
Genomic Location:
Chromosome 6 (position 26741246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTATCTTCTGAGGAAGTTCAAGAACAGCAACGGCTGGCAGAAACTAT[G/A]GGTTGTCTTCACCAACTTCTGCCTGTTCTTCTATAAGACGCACCAGGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link