FARP2

Ensembl ID:
ENSDARG00000016429
Description:
FERM, RhoGEF and pleckstrin domain protein 2 [Source:HGNC Symbol;Acc:16460]
Human Orthologue:
FARP2
Human Description:
FERM, RhoGEF and pleckstrin domain protein 2 [Source:HGNC Symbol;Acc:16460]
Mouse Orthologue:
Farp2
Mouse Description:
FERM, RhoGEF and pleckstrin domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385126]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18842 Nonsense Mutation detected in F1 DNA During 2014
sa3581 Nonsense Mutation detected in F1 DNA During 2014
sa15550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 355 1044 10 26
ENSDART00000013400 Nonsense 355 1044 10 26
Genomic Location:
Chromosome 6 (position 26713270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCATAAAACCTTATATTTCAATTTATATTTAACAGTGGGAGGACA[C/T]AGAAACAGCTTGTTGAGTATGTGAGGGACAGCGGGTTGAGAAGAACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 355 1044 10 26
ENSDART00000013400 Nonsense 355 1044 10 26
Genomic Location:
Chromosome 6 (position 26713270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTCAKAAAACCTTAYATTTCAATTTATATTTAACAGTGGGAGGACA[C/T]AGAAACAGCTTGTTGAGTATGTGAGGGACAGCGGGTTRAGAAGAACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013400 Nonsense 382 1044 11 26
Genomic Location:
Chromosome 6 (position 26713480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWGTATTGATTATTCKATTTTTACAGGAGRAACAGTAAGATTCGCATGT[C/A]GAYGCGTTCCTTGGCTTCTGATGTGCCAAAACAGGTCAGCAGAGTTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/chevlqpx