dhtkd1

Ensembl ID:
ENSDARG00000016415
ZFIN ID:
ZDB-GENE-041212-44
Description:
Probable 2-oxoglutarate dehydrogenase E1 component DHKTD1, mitochondrial [Source:UniProtKB/Swiss-Pro
Human Orthologue:
DHTKD1
Human Description:
dehydrogenase E1 and transketolase domain containing 1 [Source:HGNC Symbol;Acc:23537]
Mouse Orthologue:
Dhtkd1
Mouse Description:
dehydrogenase E1 and transketolase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2445096]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44234 Nonsense Mutation detected in F1 DNA During 2017
sa39471 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003252 Nonsense 70 925 2 17
Genomic Location (Zv9):
Chromosome 25 (position 8318128)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7930652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCTTGTGTAAACAGATCACGGACTGGCGAGACTGGTGGAGGCCTAT[C/T]GAGCACATGGACACAAAGTAGCTAAAATTAACCCCTTACTACCACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003252 Nonsense 755 925 13 17
Genomic Location (Zv9):
Chromosome 25 (position 8301461)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7913985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATGGCGGTGGTGAATCCCACACTTCCAGCTCAATACTTCCATCTTT[T/A]GAGGAGGCAGATGATCAGAAACTTCCGGAAACCGCTGATCGTGGCCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link