ptch1

Ensembl ID:
ENSDARG00000016404
ZFIN ID:
ZDB-GENE-980526-196
Description:
Patched 2 [Source:UniProtKB/TrEMBL;Acc:B0UXP5]
Human Orthologue:
PTCH1
Human Description:
patched 1 [Source:HGNC Symbol;Acc:9585]
Mouse Orthologue:
Ptch1
Mouse Description:
patched homolog 1 Gene [Source:MGI Symbol;Acc:MGI:105373]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7141 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17883 Nonsense Available for shipment Available now
sa21322 Essential Splice Site Available for shipment Available now
sa9464 Nonsense Available for shipment Available now
sa21323 Nonsense Available for shipment Available now
sa784 Nonsense Available for shipment Available now
sa34430 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Essential Splice Site 208 1242 5 23
ENSDART00000121923 Essential Splice Site 208 1475 5 24
ENSDART00000148258 Essential Splice Site 88 1355 3 21
Genomic Location (Zv9):
Chromosome 8 (position 30834765)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29977491
KASP Assay ID:
554-4850.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGAAGGACCTARAGGCTGGKGATTGTAATAGTGYGTATTTCTTKTCA[G/A]ATCTTAGAAAAACTGCACCCTTGTCTTGYCATCACTCCTCTGGACTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Nonsense 602 1242 13 23
ENSDART00000121923 Nonsense 602 1475 13 24
ENSDART00000148258 Nonsense 482 1355 11 21
Genomic Location (Zv9):
Chromosome 8 (position 30864999)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30007725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATGGACCTGTATCGCAGAGAGGACCGCCGCTTTGACATYTTCTGCTG[C/A]TTTGTCAGGTAATTCACATATTCAACTGGCTAAAKAAAGGCYCGATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Essential Splice Site 769 1242 14 23
ENSDART00000121923 Essential Splice Site 769 1475 14 24
ENSDART00000148258 Essential Splice Site 649 1355 12 21
Genomic Location (Zv9):
Chromosome 8 (position 30869913)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30012639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGCTGAAAAGCACTACGCACCATTTCTGCTTCAGTCTACAACGAAGG[T/A]AAGGCTAAAATGCTTTTTTTGCAATTGTGTTATATTTTGGAGGCCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Nonsense 823 1242 15 23
ENSDART00000121923 Nonsense 823 1475 15 24
ENSDART00000148258 Nonsense 703 1355 13 21
Genomic Location (Zv9):
Chromosome 8 (position 30870312)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30013038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGACTTCATACGTGCCCAGTTCCGTTATTTTTCATTCTACAACATGTA[C/A]GTGGTGACCCAGAGGGCGGACTACGCACAGATCCAGCCTCAGCTCTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Nonsense 1035 1242 18 23
ENSDART00000121923 Nonsense 1035 1475 18 24
ENSDART00000148258 Nonsense 915 1355 16 21
Genomic Location (Zv9):
Chromosome 8 (position 30895585)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30038311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTCCCAGCTACCCCAACGGCTACCCCTTCCTCTTCTGGGAGCAGTA[T/A]GTAGGCCTACGCCACTGGCTCCTGCTTTCCATCAGCGTTGTGCTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640 Nonsense 1217 1242 22 23
ENSDART00000121923 Nonsense 1217 1475 22 24
ENSDART00000148258 Nonsense 1097 1355 20 21
Genomic Location (Zv9):
Chromosome 8 (position 30911339)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30054065
KASP Assay ID:
554-0689.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGATGGGCRAAGCCGGCTGCCCACCCCGTCTCCAGAGCCTCCRCCA[C/T]AGGTGGTCCGCTTCACCATGCGYCCAAGTCACAYGACCCCTGGAGCTGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007640   None 1242 None 23
ENSDART00000121923 Nonsense 1425 1475 23 24
ENSDART00000148258 Nonsense 1305 1355 21 21
Genomic Location (Zv9):
Chromosome 8 (position 30914067)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30056793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCCAGTCAGAGCCCCGCGTACCCGTCCTACCCCTCCAATGACAGCTA[T/A]CAGACTTCAGGAGACGTCCACAATGACCCACACTTCTCCGACCCTCACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link