riok1

Ensembl ID:
ENSDARG00000016399
ZFIN ID:
ZDB-GENE-040426-1927
Description:
serine/threonine-protein kinase RIO1 [Source:RefSeq peptide;Acc:NP_998160]
Human Orthologue:
RIOK1
Human Description:
RIO kinase 1 (yeast) [Source:HGNC Symbol;Acc:18656]
Mouse Orthologue:
Riok1
Mouse Description:
RIO kinase 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16452 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022765 Nonsense 172 552 6 17

The following transcripts of ENSDARG00000016399 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 20864505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGGTTTTGGACCCCCGGACACGTATGATTCTGTTCAAAATGCTTAGC[A/T]GAGGCGTCTTTTCACAGATCAATGGCTGTATCAGCACTGGCAAAGAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/39wsl6r7