NP_001003595.1

Ensembl ID:
ENSDARG00000016398
Description:
calcium activated nucleotidase 1b [Source:RefSeq peptide;Acc:NP_001003595]
Human Orthologue:
CANT1
Human Description:
calcium activated nucleotidase 1 [Source:HGNC Symbol;Acc:19721]
Mouse Orthologue:
Cant1
Mouse Description:
calcium activated nucleotidase 1 Gene [Source:MGI Symbol;Acc:MGI:1923275]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35167 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012672 Essential Splice Site 210 400 2 4
Genomic Location (Zv9):
Chromosome 11 (position 45931055)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44716219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTGCCATGGGTCATTCTGACAGATGGAGACGGCAGCGTATCTAAAGG[T/C]AAAACTAACATTAAAAATAATAAACTAGGGCCTGTTCCATGATGCCGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link