tceb3

Ensembl ID:
ENSDARG00000016391
ZFIN ID:
ZDB-GENE-031118-126
Description:
transcription elongation factor B (SIII), polypeptide 3 [Source:RefSeq peptide;Acc:NP_956415]
Human Orthologue:
CALCOCO1
Human Description:
calcium binding and coiled-coil domain 1 [Source:HGNC Symbol;Acc:29306]
Mouse Orthologue:
Calcoco1
Mouse Description:
calcium binding and coiled coil domain 1 Gene [Source:MGI Symbol;Acc:MGI:1914738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45419 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008409 Essential Splice Site 376 560 9 14
Genomic Location (Zv9):
Chromosome 11 (position 2070107)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2172411
GRCz11 11 2117653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAATATCTAAGTGTGAAAATTGATATTTTTATTTCATGGTGCTGTAAA[G/A]CTGGATAAGGACCGTGTCCAGAAATTGAGCCGTGAGCTCCAGAAGAAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link