ENSDARG00000016381

Ensembl ID:
ENSDARG00000016381
Human Orthologue:
WNK4
Human Description:
WNK lysine deficient protein kinase 4 [Source:HGNC Symbol;Acc:14544]
Mouse Orthologue:
Wnk4
Mouse Description:
WNK lysine deficient protein kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1917097]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16795 Nonsense Available for shipment Available now
sa547 Nonsense F2 line generated During 2014
sa11247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088587 Nonsense 125 199 3 4
ENSDART00000088587 Nonsense 125 199 3 4
Genomic Location:
Chromosome 12 (position 4249479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATATTGTGTTWAACAGGAACYCCTGAATTCATGGCTCCTGAAATGTA[T/G]GAGGAGAAATAYGAYGAGGCGGTGRACGTTTATGCATTTGGCATGTGWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa547
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088587 Nonsense 125 199 3 4
ENSDART00000088587 Nonsense 125 199 3 4
Genomic Location:
Chromosome 12 (position 4249479)
KASP Assay ID:
554-0457.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATATTGTGTTTAACAGGAACTCCTGAATTCATGGCTCCTGAAATGTA[T/A]GAGGAGAAATAYGAYGAGGCGGTGGACGTTTATGCATTTGGCATGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088587 Nonsense 141 199 3 4
Genomic Location:
Chromosome 12 (position 4249527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWGAGGAGAAATAYGAYGAGGCGGTGRACGTTTATGCATTTGGCATGTG[T/A]ATCTTGGAGATGACCACATCCGAATACCCRTATTCAGAGTGCCAAAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/37iug20u