asns

Ensembl ID:
ENSDARG00000016375
ZFIN ID:
ZDB-GENE-040426-1091
Description:
asparagine synthetase [Source:RefSeq peptide;Acc:NP_957457]
Human Orthologue:
ASNS
Human Description:
asparagine synthetase (glutamine-hydrolyzing) [Source:HGNC Symbol;Acc:753]
Mouse Orthologue:
Asns
Mouse Description:
asparagine synthetase Gene [Source:MGI Symbol;Acc:MGI:1350929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4079 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022676 Essential Splice Site 412 560 9 13
ENSDART00000121476 Essential Splice Site 412 560 9 12
ENSDART00000124652 Essential Splice Site 412 560 8 11
ENSDART00000022676 Essential Splice Site 412 560 9 13
ENSDART00000121476 Essential Splice Site 412 560 9 12
ENSDART00000124652 Essential Splice Site 412 560 8 11
Genomic Location:
Chromosome 19 (position 26147586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATCTGTTCGATGTGCTGAGAGCCGACAGAACCACTGCTGCTCATGGG[T/C]AACACCGACTGTCCCTTAWCTTTACTGGCCACATATCACTGTGTCAGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fvdce2i0