her8a

Ensembl ID:
ENSDARG00000016363
ZFIN ID:
ZDB-GENE-030131-2376
Description:
hairy-related 8a [Source:RefSeq peptide;Acc:NP_955918]
Human Orthologue:
HES6
Human Description:
hairy and enhancer of split 6 (Drosophila) [Source:HGNC Symbol;Acc:18254]
Mouse Orthologue:
Hes6
Mouse Description:
hairy and enhancer of split 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859852]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34072 Nonsense Mutation detected in F1 DNA During 2017
sa40894 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019035 Nonsense 20 221 1 5
ENSDART00000123395 Nonsense 52 253 1 4
Genomic Location (Zv9):
Chromosome 7 (position 27562197)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26165136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCAACATGGGCAATGGTCCGGAGAAGAATTTCAACGCAAAAGAGGAG[C/T]GAAAGGTAATGTCACATTTGCGGCATTTTGTGCGGTTTGATGATGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019035 Essential Splice Site 79 221 3 5
ENSDART00000123395 Essential Splice Site 111 253 3 4
Genomic Location (Zv9):
Chromosome 7 (position 27560375)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26163314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATCACAGTTCAGCACATGGAGAATCTTCAAAGAGGTCATGGACAGG[G/A]TTAGACATTCTGTGCATCATTTCTTTACTTTTCTCACACATATTAAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link