si:ch211-161h7.7

Ensembl ID:
ENSDARG00000016360
ZFIN ID:
ZDB-GENE-091116-39
Human Orthologue:
KPNA1
Human Description:
karyopherin alpha 1 (importin alpha 5) [Source:HGNC Symbol;Acc:6394]
Mouse Orthologue:
Kpna1
Mouse Description:
karyopherin (importin) alpha 1 Gene [Source:MGI Symbol;Acc:MGI:103560]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13233 Nonsense Available for shipment Available now
sa13220 Nonsense Available for shipment Available now
sa37876 Essential Splice Site Available for shipment Available now
sa24488 Nonsense Available for shipment Available now
sa24487 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025348 Nonsense 142 580 4 14
ENSDART00000142080 Nonsense 151 589 4 14
ENSDART00000025348 Nonsense 142 580 4 14
ENSDART00000142080 Nonsense 151 589 4 14
Genomic Location (Zv9):
Chromosome 24 (position 21561668)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20808797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTCTGAAGACATGATACAGATGATCTTCTCCAGCTCTCCAGAACAA[C/T]AGCTCATAGGAACACAGCGCTTCAGAAAGCTCTTATCTAAAGGTGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025348 Nonsense 142 580 4 14
ENSDART00000142080 Nonsense 151 589 4 14
ENSDART00000025348 Nonsense 142 580 4 14
ENSDART00000142080 Nonsense 151 589 4 14
Genomic Location (Zv9):
Chromosome 24 (position 21561668)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20808797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTCTGAAGACATGATACAGATGATCTTCTCCAGCTCTCCAGAACAA[C/T]AGCTCATAGGAACACAGCGCTTCAGAAAGCTCTTATCTAAAGGTGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025348 Essential Splice Site 295 580 9 14
ENSDART00000142080 Essential Splice Site 304 589 9 14
Genomic Location (Zv9):
Chromosome 24 (position 21558043)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20805172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCTTAACCTTAAAGTGCAATCTAAGTTGTATTTGTTTTTTTTATGC[A/T]GGTGTCACCGTGTCTCAGTGTTCTGTCCTGGCTGCTGTTTGTGAATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025348 Nonsense 341 580 9 14
ENSDART00000142080 Nonsense 350 589 9 14
Genomic Location (Zv9):
Chromosome 24 (position 21557901)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20805030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATGGTCCCAATGAGAAGATCCAGGCTGTTATTGACTCAGGAGTCTG[T/A]CGCAGACTAGTGGAGCTGCTGCTGTAAGACATCAAAACAGATAGGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025348 Nonsense 458 580 12 14
ENSDART00000142080 Nonsense 467 589 12 14
Genomic Location (Zv9):
Chromosome 24 (position 21554708)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20801837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGCAGCATGGGCAATCACGAATGCCACATCTGGAGGATCCGCAGAA[C/T]AAATCAGGTGATGCAGAACACCAGTTAAACCTGGCTACTTCTAATCTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link