LOC568954

Ensembl ID:
ENSDARG00000016348
Human Orthologue:
DIP2B
Human Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) [Source:HGNC Symbol;Acc:29284]
Mouse Orthologue:
Dip2b
Mouse Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145977]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18847 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11944 Essential Splice Site Available for shipment Available now
sa15891 Nonsense Available for shipment Available now
sa31527 Nonsense Mutation detected in F1 DNA During 2016
sa38568 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 592 1603 14 39
ENSDART00000044276 Essential Splice Site 592 1603 14 39
Genomic Location:
Chromosome 6 (position 39492816)
KASP Assay ID:
2259-7857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGGACTTTAAGAAGGACATGGGATTGTGGCATGGAGTTCTAACGG[T/C]GAGAGGAAATAAATGTGTATATGTCATCACTGGTAATGCTGAATTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 592 1603 14 39
ENSDART00000044276 Essential Splice Site 592 1603 14 39
Genomic Location:
Chromosome 6 (position 39492816)
KASP Assay ID:
2259-7857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTYTGGACTTTAAGAAGGACATGGGATTGTGGCATGGAGTTCTAACGG[T/C]GAGAGGAAATAAATGTGTATAWGTCATCACTGGTAATGCTGAATTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Nonsense 948 1603 23 39
Genomic Location:
Chromosome 6 (position 39484705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCTCAGACACCAAACAGCTGTTYCTAGAGGGRGCACTACATCCCYG[C/A]AACATTCTCATGTGYCCACACACCTGYGTCACCAAMATGCCCAAACCAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Nonsense 968 1603 23 39
Genomic Location:
Chromosome 6 (position 39484647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGTGCCCACACACCTGCGTCACCAACATGCCCAAACCACGCCAGAAA[C/T]AACCAGGTGTGTTTTTTAAACCATAAATCTGCTTTTACATACACAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 1083 1603 27 39
Genomic Location:
Chromosome 6 (position 39482703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGTGGCATTAACATCGGAGAAAATGTGGTGCTTTTGTATCCTCCAG[G/A]TAAACAACACTCCTTTAACAATGCGTATAATGAAGGGCTATAAACAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 1520 1603 38 39
Genomic Location:
Chromosome 6 (position 39463149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACATCGAGACCAGTGTGTCTCGTGCCCACCGCAGCATTGGTGAAAGG[T/A]AACTTTGCTTTAAGAGGGCCACATTATGCTTTCTGTACTAGTTAAACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link