lctlb

Ensembl ID:
ENSDARG00000016337
ZFIN ID:
ZDB-GENE-060503-93
Description:
lactase-like b [Source:RefSeq peptide;Acc:NP_001093484]
Human Orthologue:
LCTL
Human Description:
lactase-like [Source:HGNC Symbol;Acc:15583]
Mouse Orthologue:
Lctl
Mouse Description:
lactase-like Gene [Source:MGI Symbol;Acc:MGI:2183549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4021 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100557 Nonsense 291 561 8 13
ENSDART00000130329 Nonsense 300 585 8 14
Genomic Location:
Chromosome 18 (position 19256392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATATGTCCAGTTTTACATTGGCTGGTTTGCTACGCCCATCTTCCAT[G/T]GAGATTATCCTCAAGTGATGAAGGWTTTCATTGGTATTAGTGCTAAATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r378i1wp