c9

Ensembl ID:
ENSDARG00000016319
ZFIN ID:
ZDB-GENE-050522-442
Description:
complement component 9 [Source:RefSeq peptide;Acc:NP_001019606]
Human Orthologue:
C9
Human Description:
complement component 9 [Source:HGNC Symbol;Acc:1358]
Mouse Orthologue:
C9
Mouse Description:
complement component 9 Gene [Source:MGI Symbol;Acc:MGI:1098282]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15909 Essential Splice Site Available for shipment Available now
sa598 Splice Site, Nonsense F2 line generated During 2016
sa33641 Nonsense Mutation detected in F1 DNA During 2016
sa15017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051374 Essential Splice Site 26 280 None 7
ENSDART00000115273 Essential Splice Site 26 658 None 12
ENSDART00000147132 Essential Splice Site 26 673 None 11

The following transcripts of ENSDARG00000016319 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33983014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31745246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGAGAATTGCAAAGATRMTAAATCTGATCACTRTGTATCTTTCTWAA[A/G]GTCAAGGGTCCAGACGGGAGGTGCGGCAAATAAACGATCCACCACCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa598
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051374   None 280 None 7
ENSDART00000115273 Splice Site, Nonsense 349 658 8 12
ENSDART00000147132 Splice Site, Nonsense 364 673 7 11

The following transcripts of ENSDARG00000016319 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33988949)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31751181
KASP Assay ID:
554-0508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATATATATATTTCATGCTTTTATGACCAGCACATCTTCTCTATTTCAG[A/T]GAAAGACCTTCATGAGAGTAAAAGGCAGAGTGGAGYTGGCCWCATACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051374   None 280 None 7
ENSDART00000115273 Nonsense 397 658 8 12
ENSDART00000147132 Nonsense 412 673 7 11

The following transcripts of ENSDARG00000016319 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33989094)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31751326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGATGCTCTGCCACTACAGTATGAGAAGGGGCAGTATTTTAGTTTCT[T/A]GGAGGAATATGGAACACATTTTACTAAGAACGGAAAGTCTGGTGGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051374   None 280 None 7
ENSDART00000115273 Nonsense 479 658 10 12
ENSDART00000147132 Nonsense 494 673 9 11

The following transcripts of ENSDARG00000016319 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33991971)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31754203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTAAAAACTATTRTGCACAAACTTGCTCACCAGATGAGAAAAACAAC[A/T]AGGGGGTTATTGATAAGGTCCTGATTGAAGTGAAAGGGGGYAGTGCAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link