tfdp1b

Ensembl ID:
ENSDARG00000016304
ZFIN ID:
ZDB-GENE-040426-1746
Description:
transcription factor Dp-1, b [Source:RefSeq peptide;Acc:NP_957070]
Human Orthologues:
TFDP1, TFDP3
Human Descriptions:
transcription factor Dp family, member 3 [Source:HGNC Symbol;Acc:24603]
transcription factor Dp-1 [Source:HGNC Symbol;Acc:11749]
Mouse Orthologue:
Tfdp1
Mouse Description:
transcription factor Dp 1 Gene [Source:MGI Symbol;Acc:MGI:101934]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3365 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003317 Essential Splice Site 226 385 8 12
ENSDART00000137356 None None 148 None 6
ENSDART00000145758 Essential Splice Site 222 266 8 9
ENSDART00000146722 Essential Splice Site 222 346 8 11
ENSDART00000146971 Essential Splice Site 219 254 8 9

The following transcripts of ENSDARG00000016304 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 111857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGAGAATCAAGCAGAAGCAGTCWCAGCTGCAGGAGCTCATTGTGCAG[G/A]TACAGCACCGCANNNNNTCTTGATATTGTTCAGTCACRTGAGAATTGNNNNNNAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5v0jmp1t