upf1

Ensembl ID:
ENSDARG00000016302
ZFIN ID:
ZDB-GENE-040426-2836
Description:
regulator of nonsense transcripts 1 [Source:RefSeq peptide;Acc:NP_998639]
Human Orthologue:
UPF1
Human Description:
UPF1 regulator of nonsense transcripts homolog (yeast) [Source:HGNC Symbol;Acc:9962]
Mouse Orthologue:
Upf1
Mouse Description:
UPF1 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107995]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3416 Nonsense Mutation detected in F1 DNA During 2014
sa7535 Missense Mutation detected in F1 DNA During 2014
sa11856 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Nonsense 343 1100 8 24
ENSDART00000138047 Nonsense 343 557 8 13
Genomic Location:
Chromosome 2 (position 56407158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGTGATGTCTATCAGACATGCGGCTGATGCAAGGAGACGAGATCTG[T/A]CTGCGCTATAAAGGAGACATGGCTCCGCTCTGGAAAGGCATCGGACATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Missense 451 1100 10 24
ENSDART00000138047 Missense 451 557 10 13
Genomic Location:
Chromosome 2 (position 56412049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAAATGCCAGCTACCYAAACGCTTCACTGCGCAGGGCCTGCCAGACC[T/C]CAACCACTCGCAGGTACAGARATGWACAAACTSRCATCTYTCTCWTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Essential Splice Site 906 1100 20 24
ENSDART00000138047 None None 557 None 13
Genomic Location:
Chromosome 2 (position 56435088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATACATMRAAGGCCATRAAGTCCATCTGACAGTGTWAATGTTTGTTTC[A/T]GGGAGCCCGCTTCATGAGTACCGCCATGTATGATGCAAGGGAGGYCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sumnu8bc