ebf3

Ensembl ID:
ENSDARG00000016300
ZFIN ID:
ZDB-GENE-070112-292
Description:
transcription factor COE3 [Source:RefSeq peptide;Acc:NP_001074071]
Human Orthologue:
EBF3
Human Description:
early B-cell factor 3 [Source:HGNC Symbol;Acc:19087]
Mouse Orthologue:
Ebf3
Mouse Description:
early B-cell factor 3 Gene [Source:MGI Symbol;Acc:MGI:894289]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18240 Essential Splice Site Available for shipment Available now
sa22167 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Essential Splice Site 297 548 10 16
ENSDART00000138241 None None 128 None 3
Genomic Location:
Chromosome 12 (position 44171339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGTGCAGTTTGCAAGRTCCTAACCAAGTTTATCYATTCTCTCCTAT[A/G]GCTCATTACACCCCATGCCRTCCGAGTGCAGACCCCTCCRAGACACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Essential Splice Site 368 548 11 16
ENSDART00000138241 None None 128 None 3
Genomic Location:
Chromosome 12 (position 44151775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAAGGTCATTCCCAGACATCCAGGTGATCCGGAGAGGTTGCCCAAG[G/A]TCAGTGATCCTGTGTGTGTGCGTGCTTGTGTGAAGCAGCTATTTATCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/76gm35pb