ebf3

Ensembl ID:
ENSDARG00000016300
ZFIN ID:
ZDB-GENE-070112-292
Description:
transcription factor COE3 [Source:RefSeq peptide;Acc:NP_001074071]
Human Orthologue:
EBF3
Human Description:
early B-cell factor 3 [Source:HGNC Symbol;Acc:19087]
Mouse Orthologue:
Ebf3
Mouse Description:
early B-cell factor 3 Gene [Source:MGI Symbol;Acc:MGI:894289]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18240 Essential Splice Site Available for shipment Available now
sa22167 Essential Splice Site Available for shipment Available now
sa35372 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35371 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Essential Splice Site 297 548 10 16
ENSDART00000138241   None 128 None 3
Genomic Location (Zv9):
Chromosome 12 (position 44171339)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42392450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGTGCAGTTTGCAAGRTCCTAACCAAGTTTATCYATTCTCTCCTAT[A/G]GCTCATTACACCCCATGCCRTCCGAGTGCAGACCCCTCCRAGACACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Essential Splice Site 368 548 11 16
ENSDART00000138241   None 128 None 3
Genomic Location (Zv9):
Chromosome 12 (position 44151775)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42412014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAAGGTCATTCCCAGACATCCAGGTGATCCGGAGAGGTTGCCCAAG[G/A]TCAGTGATCCTGTGTGTGTGCGTGCTTGTGTGAAGCAGCTATTTATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Essential Splice Site 369 548 12 16
ENSDART00000138241   None 128 None 3
Genomic Location (Zv9):
Chromosome 12 (position 44146878)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42416911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTGATGGTGTTTATATGTCTTTATGACTGATTATGTTGCATATTGC[A/G]GGAGGTGTTGCTAAAGAGAGCCGCTGACCTTGTGGAAGCGCTGTACGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085381 Nonsense 507 548 14 16
ENSDART00000138241 Nonsense 51 128 1 3
Genomic Location (Zv9):
Chromosome 12 (position 44144779)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42419010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCTAGTTCACCGGGCTTCTTAAATGGCTCCTCTGCGAACTCTCCCTA[C/A]GGCAGTAAGTATCAAGGTAATGACGAGCTCCCCGCTCTCTCTGTCCCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link