NP_001104232.1

Ensembl ID:
ENSDARG00000016293
Description:
vasorin like [Source:RefSeq peptide;Acc:NP_001104232]
Human Orthologue:
VASN
Human Description:
vasorin [Source:HGNC Symbol;Acc:18517]
Mouse Orthologue:
Vasn
Mouse Description:
vasorin Gene [Source:MGI Symbol;Acc:MGI:2177651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6027 Nonsense Mutation detected in F1 DNA During 2017
sa33106 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026190 Nonsense 315 668 3 3
Genomic Location (Zv9):
Chromosome 3 (position 12678314)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12332038
KASP Assay ID:
554-3653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCCTTTCAACTGTCTCTGTAATMTGGCTTGGTTTCCTAGTTGGCTG[C/T]GAACTAAGCAAATTCAGTTGGGCAGGACAGAAGAGACACGCTGCCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026190 Nonsense 346 668 3 3
Genomic Location (Zv9):
Chromosome 3 (position 12678221)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12332131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATTTTCCTCCTCTAAATTCTGGGAAGGTGCTGGAAAGACTGGGCCAC[A/T]GAGAATTTGGATGTCCGATTACCACAACTATTACAACTCGCATGGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link