clca1

Ensembl ID:
ENSDARG00000016290
ZFIN ID:
ZDB-GENE-030131-6221
Human Orthologues:
CLCA1, CLCA2, CLCA4
Human Descriptions:
chloride channel accessory 1 [Source:HGNC Symbol;Acc:2015]
chloride channel accessory 2 [Source:HGNC Symbol;Acc:2016]
chloride channel accessory 4 [Source:HGNC Symbol;Acc:2018]
Mouse Orthologues:
AI747448, Clca1, Clca2, Clca3, Clca4, Clca5, Clca6, Gm6289
Mouse Descriptions:
chloride channel calcium activated 1 Gene [Source:MGI Symbol;Acc:MGI:1316732]
chloride channel calcium activated 2 Gene [Source:MGI Symbol;Acc:MGI:1931471]
chloride channel calcium activated 3 Gene [Source:MGI Symbol;Acc:MGI:1346342]
chloride channel calcium activated 4 Gene [Source:MGI Symbol;Acc:MGI:2181989]
chloride channel calcium activated 5 Gene [Source:MGI Symbol;Acc:MGI:2139758]
chloride channel calcium activated 6 Gene [Source:MGI Symbol;Acc:MGI:2139744]
expressed sequence AI747448 Gene [Source:MGI Symbol;Acc:MGI:2139790]
predicted gene 6289 Gene [Source:MGI Symbol;Acc:MGI:3643218]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9888 Essential Splice Site Available for shipment Available now
sa1839 Essential Splice Site Available for shipment Available now
sa24978 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047531 Essential Splice Site 390 908 7 14
Genomic Location:
Chromosome 15 (position 14145977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCCAGRTGGATMCACAAACATGTGTAATGGCCTTCGTCTAGGCTTACAG[G/A]TACCRAATGAATTGWTRATTTTATGWTTGTAGKGCAGGNATTACAGTGNNTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047531 Essential Splice Site 391 908 8 14
Genomic Location:
Chromosome 15 (position 14146065)
KASP Assay ID:
554-1830.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTACAGTGTTTTTTGTGCTAATGCNTTTCTGTTTTCCTCAAAACCTTC[A/T]GGTACTTTCAGAAGACGACATGGATGCAATAGGAGATGAAATAATTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047531 Essential Splice Site 779 908 14 14
Genomic Location:
Chromosome 15 (position 14152346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAATGCTAGAAAGTTAGATCATGAAATAATGTATCTTGAATTATCCC[A/C]GCTAAATCTTACGAGATCAGATGGAGCTTTGACCTGGACATGCTTCGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dt06f3d8