fxr2

Ensembl ID:
ENSDARG00000016260
ZFIN ID:
ZDB-GENE-040426-943
Description:
fragile X mental retardation syndrome-related protein 2 [Source:RefSeq peptide;Acc:NP_956505]
Human Orthologue:
FXR2
Human Description:
fragile X mental retardation, autosomal homolog 2 [Source:HGNC Symbol;Acc:4024]
Mouse Orthologue:
Fxr2
Mouse Description:
fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1346074]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11430 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027718 Splice Site, Nonsense 448 676 12 17
ENSDART00000143341 Splice Site, Nonsense 448 583 12 15
Genomic Location:
Chromosome 7 (position 23906210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGAGGAAGAGGACGCGGACGCAAACCGAACAATACATACTCCGGCTA[T/A]GGTGAGACTGGAACTTACACAATGCATATCTGTCTGTGTGTGTTTARTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgM levels: Genome-wide scan identifies variant in TNFSF13 associated with serum IgM in a healthy Chinese male population. (View Study)
  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nf1m1k3k