nudt3a

Ensembl ID:
ENSDARG00000016256
ZFIN ID:
ZDB-GENE-040426-792
Description:
diphosphoinositol polyphosphate phosphohydrolase 2 [Source:RefSeq peptide;Acc:NP_957439]
Human Orthologue:
NUDT3
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 3 [Source:HGNC Symbol;Acc:8050]
Mouse Orthologue:
Nudt3
Mouse Description:
nudix (nucleotide diphosphate linked moiety X)-type motif 3 Gene [Source:MGI Symbol;Acc:MGI:1928484]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa380 Essential Splice Site Available for shipment Available now
sa25190 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026978 Essential Splice Site 71 170 3 7
ENSDART00000061713 Essential Splice Site 71 170 3 6
ENSDART00000141682 Essential Splice Site 71 170 3 5
Genomic Location (Zv9):
Chromosome 23 (position 3729704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3773079
KASP Assay ID:
554-0360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAAATGTCCTGAATTGAGTGTTTCACTGTTTTTTTTTTTATTCCCAC[A/T]GGCAGGAGTCAAAGGTACATTAGGAAGATTGGTAGGTGTTTTTGAGGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026978   None 170 7 7
ENSDART00000061713 Essential Splice Site None 170 6 6
ENSDART00000141682   None 170 5 5
Genomic Location (Zv9):
Chromosome 23 (position 3726027)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3769402
KASP Assay ID:
554-7411.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTAATGCGATTAGTTGACTTTAAAGTTGGTAAACTCGTTTCTTTTAA[A/T]GGGGTGGTCCACTATGATATCATATTTTAAACTTTAGTTGATGTGTAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link