psmd13

Ensembl ID:
ENSDARG00000016239
ZFIN ID:
ZDB-GENE-040426-1004
Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 [Source:RefSeq peptide;Acc:NP_957242]
Human Orthologue:
PSMD13
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 [Source:HGNC Symbol;Acc:9558]
Mouse Orthologue:
Psmd13
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene [Source:MGI Symbol;Acc:MGI:1345192]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5997 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17160 Essential Splice Site Available for shipment Available now
sa10990 Essential Splice Site Available for shipment Available now
sa39475 Nonsense Mutation detected in F1 DNA During 2017
sa38015 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027625 Essential Splice Site 85 402 4 14
ENSDART00000104576 Essential Splice Site 61 378 3 13

The following transcripts of ENSDARG00000016239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 10699322)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10391373
KASP Assay ID:
554-3764.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACACTACTTAAATGTGCCACAAAACCTTTTATATGTCTGTTTTCCACA[G/A]CTCTACGAAAACTTCCTCTGTGATTTCGAACACAGGTAARAAGCCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027625 Essential Splice Site 159 402 8 14
ENSDART00000104576 Essential Splice Site 135 378 7 13
ENSDART00000027625 Essential Splice Site 159 402 8 14
ENSDART00000104576 Essential Splice Site 135 378 7 13

The following transcripts of ENSDARG00000016239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 10700976)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10393027
KASP Assay ID:
2261-9423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAATCATAACCTGTTCAAATCTAACCCAYGAATAATGCCCATTCTCC[A/T]GAAATTAATAGAAGAAGTGGAAGAGATGYTGAACAATCTCCCGGGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027625 Essential Splice Site 159 402 8 14
ENSDART00000104576 Essential Splice Site 135 378 7 13
ENSDART00000027625 Essential Splice Site 159 402 8 14
ENSDART00000104576 Essential Splice Site 135 378 7 13

The following transcripts of ENSDARG00000016239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 10700976)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10393027
KASP Assay ID:
2261-9423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAATCATAACCTGTTCAAATCTAACCCAYGAATAATGCCCATTCTCC[A/T]GAAATTAATAGAAGAAGTGGAAGAGATGCTGAACAATCTCCCGGGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027625 Nonsense 199 402 8 14
ENSDART00000104576 Nonsense 175 378 7 13

The following transcripts of ENSDARG00000016239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 10701100)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10393151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGTCCAGCAAGTATTACCGCATCATTGGGAACCACGCTTTATACTA[C/A]AAGGACGCCCTGCGATACCTGGGCTGTGTGGAAGCTAAAGACTTGCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027625 Essential Splice Site 215 402 8 14
ENSDART00000104576 Essential Splice Site 191 378 7 13

The following transcripts of ENSDARG00000016239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 10701150)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10393201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGACGCCCTGCGATACCTGGGCTGTGTGGAAGCTAAAGACTTGCCAG[G/A]TAAATATAATGATGGCTGATGTTTACACTTTCACCACAGGATTCTTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link