LOC556557

Ensembl ID:
ENSDARG00000016213
Human Orthologue:
RDH8
Human Description:
retinol dehydrogenase 8 (all-trans) [Source:HGNC Symbol;Acc:14423]
Mouse Orthologue:
Rdh8
Mouse Description:
retinol dehydrogenase 8 Gene [Source:MGI Symbol;Acc:MGI:2685028]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20146 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016405 Essential Splice Site 147 310 4 6
Genomic Location:
Chromosome 3 (position 54157142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAAGCCGCAAAAAATAGTTGAATACTGAAAGTTTTTCCTTCCCCATGC[A/T]GGGCTACTCTTCAATGATTTGTATGCTGCTTCCAAATTTGCTGTAGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cg49nhyb