A5PLH2_DANRE

Ensembl ID:
ENSDARG00000016212
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A5PLH2]
Human Orthologue:
NUP214
Human Description:
nucleoporin 214kDa [Source:HGNC Symbol;Acc:8064]
Mouse Orthologue:
Nup214
Mouse Description:
nucleoporin 214 Gene [Source:MGI Symbol;Acc:MGI:1095411]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12991 Splice Site, Nonsense Available for shipment Available now
sa5342 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa20597 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035580 None None 483 None 9
ENSDART00000115182 Splice Site, Nonsense 252 2031 7 47
Genomic Location:
Chromosome 5 (position 74991238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTTAGTGTTGGACGTGTTGTGGCTGAG[C/A]ACCTACACTTTYGCGGTGGCGTACGCAGCAGCAGATGGATCTCTGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035580 None None 483 None 9
ENSDART00000115182 Splice Site, Nonsense 681 2031 14 47
Genomic Location:
Chromosome 5 (position 75052316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGGGTCAGTGTTCCTCCAGCCGCTCCTGCGTCCAGCACTCCATCGGCA[C/T]AGGTACAGCWCTGATCCATAATCAGCTGCTCTGCGTGCGTGCGTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035580 Missense 308 483 5 9
ENSDART00000115182 Essential Splice Site 1901 2031 41 47
Genomic Location:
Chromosome 5 (position 75078639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCTTCAGCAGCGGAGGCGGATCTGTGGCCGCACAGGGCTTTGGTTCC[T/C]TCTCCACTCCCACTAAACCAGGTCACATACATATACATACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eupbr9ok