trib3

Ensembl ID:
ENSDARG00000016200
ZFIN ID:
ZDB-GENE-040426-2609
Description:
tribbles homolog 3 [Source:RefSeq peptide;Acc:NP_998034]
Human Orthologue:
TRIB3
Human Description:
tribbles homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:16228]
Mouse Orthologue:
Trib3
Mouse Description:
tribbles homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345675]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7347 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036513 Missense 48 348 2 4
Genomic Location:
Chromosome 11 (position 24996110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGCCGTAGACTCAGTCAGCCTCCTTCCCCAGGTCTTGCGCCCTGCCTT[C/T]GCCCMCTGTCACAAAGCCTTGAACAGCCAGGGTCTGAAAAGCACCACGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bvyb0rsx