si:ch73-63e15.2

Ensembl ID:
ENSDARG00000016188
ZFIN ID:
ZDB-GENE-091204-463
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37491 Essential Splice Site Available for shipment Available now
sa37490 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056032 Essential Splice Site 300 1452 None 31
ENSDART00000137984   None 729 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17935153)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17686088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCATTCTAGAAAACAACTTAAAGGGAAGGAAAAAAGCACTATGG[T/A]GAGAAGCATCGACATCCAGCACAACTGACCGACTTTACTGGCACACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056032 Nonsense 855 1452 22 31
ENSDART00000137984 Nonsense 132 729 4 13
Genomic Location (Zv9):
Chromosome 22 (position 17921989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17672924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAGTTCTTTGGTGCTGACTTTTCATTTGCATTTTAATAGGGAGCTT[T/A]GACTCATGGTGACAGGAGAGCCACAGAGTCTAGAGACCTGAGCAAATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link