trim33
- Ensembl ID:
- ENSDARG00000016181
- ZFIN ID:
- ZDB-GENE-030131-2773
- Description:
- E3 ubiquitin-protein ligase TRIM33 [Source:UniProtKB/Swiss-Prot;Acc:Q6E2N3]
- Human Orthologue:
- TRIM33
- Human Description:
- tripartite motif-containing 33 [Source:HGNC Symbol;Acc:16290]
- Mouse Orthologue:
- Trim33
- Mouse Description:
- tripartite motif-containing 33 Gene [Source:MGI Symbol;Acc:MGI:2137357]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa1735 |
Essential Splice Site |
Available for shipment |
Available now |
sa2432 |
Nonsense |
F2 line generated |
During 2018 |
sa27135 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa27136 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15516 |
Nonsense |
Available for shipment |
Available now |
sa16614 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa1735
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 11702684)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10966440 |
GRCz11 |
8 |
11004145 |
- KASP Assay ID:
- 554-1680.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAGMTCACCATGCCGGTGCAAGGCCCCCACGGACAGGACACTCGAATCGG[T/A]AAGTTCGGAAAGGGGAAGTGTGATTGGTAAATTCTGTCCCGAAGGATCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2432
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 11717960)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10951164 |
GRCz11 |
8 |
10988869 |
- KASP Assay ID:
- 554-2924.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGAYCTGYGACACTCTGACCTGCAGAGACTGCCAGCTACTTGAACACAAA[G/T]AACACAGGTCAGCCGGACAGCACTGTTTACACTTTACACACAACAANNNC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27135
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 11728810)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10940314 |
GRCz11 |
8 |
10978019 |
- KASP Assay ID:
- 554-6565.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAACAACAACAACACCAACACCAACAACAGCAGCAGCAACAACAACAA[C/T]AACAACAACAACAGCAGCAGCAACAACAACAACAGCAACACCAGCAACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27136
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 11728822)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10940302 |
GRCz11 |
8 |
10978007 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACACCAACACCAACAACAGCAGCAGCAACAACAACAACAACAACAACAA[C/T]AGCAGCAGCAACAACAACAACAGCAACACCAGCAACAAATTCAGCAGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15516
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 11734451)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10934673 |
GRCz11 |
8 |
10972378 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGCTTGAAGATGCYGGCTCTAGCACACTGGATAATATCCTAAGTCGGTA[T/A]ATTTCTGCTAATGCATATCCTACTGTCGGACCCACAAACCCATCRCCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16614
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 11749397)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
10919727 |
GRCz11 |
8 |
10957432 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTTTTTTTTCCTTTTGTTTCTGTGCTGTCGTTGCCCTTTTTAGATGTCT[C/T]GAATAATCCAGGTTTATGATGAGGAGAAACAGAGTAATGTCCAGGTAAGANANN
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: