trim33

Ensembl ID:
ENSDARG00000016181
ZFIN ID:
ZDB-GENE-030131-2773
Description:
E3 ubiquitin-protein ligase TRIM33 [Source:UniProtKB/Swiss-Prot;Acc:Q6E2N3]
Human Orthologue:
TRIM33
Human Description:
tripartite motif-containing 33 [Source:HGNC Symbol;Acc:16290]
Mouse Orthologue:
Trim33
Mouse Description:
tripartite motif-containing 33 Gene [Source:MGI Symbol;Acc:MGI:2137357]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1735 Essential Splice Site Available for shipment Available now
sa2432 Nonsense F2 line generated During 2014
sa15516 Nonsense Available for shipment Available now
sa16614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020116 Essential Splice Site 194 1176 1 20
ENSDART00000111005 Essential Splice Site 76 1058 2 21
ENSDART00000139603 None None 104 None 2
Genomic Location:
Chromosome 8 (position 11702684)
KASP Assay ID:
554-1680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGMTCACCATGCCGGTGCAAGGCCCCCACGGACAGGACACTCGAATCGG[T/A]AAGTTCGGAAAGGGGAAGTGTGATTGGTAAATTCTGTCCCGAAGGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2432
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020116 Nonsense 325 1176 4 20
ENSDART00000111005 Nonsense 207 1058 5 21
ENSDART00000139603 None None 104 None 2
Genomic Location:
Chromosome 8 (position 11717960)
KASP Assay ID:
554-2924.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAYCTGYGACACTCTGACCTGCAGAGACTGCCAGCTACTTGAACACAAA[G/T]AACACAGGTCAGCCGGACAGCACTGTTTACACTTTACACACAACAANNNC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020116 Nonsense 758 1176 12 20
ENSDART00000111005 Nonsense 640 1058 13 21
ENSDART00000139603 None None 104 None 2
Genomic Location:
Chromosome 8 (position 11734451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTGAAGATGCYGGCTCTAGCACACTGGATAATATCCTAAGTCGGTA[T/A]ATTTCTGCTAATGCATATCCTACTGTCGGACCCACAAACCCATCRCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020116 Nonsense 1090 1176 19 20
ENSDART00000111005 Nonsense 972 1058 20 21
ENSDART00000139603 None None 104 None 2
Genomic Location:
Chromosome 8 (position 11749397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTCCTTTTGTTTCTGTGCTGTCGTTGCCCTTTTTAGATGTCT[C/T]GAATAATCCAGGTTTATGATGAGGAGAAACAGAGTAATGTCCAGGTAAGANANN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9a5blxxu