eif4enif1

Ensembl ID:
ENSDARG00000016177
ZFIN ID:
ZDB-GENE-050320-113
Description:
eukaryotic translation initiation factor 4E transporter [Source:RefSeq peptide;Acc:NP_001013556]
Human Orthologue:
EIF4ENIF1
Human Description:
eukaryotic translation initiation factor 4E nuclear import factor 1 [Source:HGNC Symbol;Acc:16687]
Mouse Orthologue:
Eif4enif1
Mouse Description:
eukaryotic translation initiation factor 4E nuclear import factor 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9362 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002728 Essential Splice Site 444 747 11 16
ENSDART00000123022 Essential Splice Site 641 944 13 18
ENSDART00000133599 Essential Splice Site 641 944 14 19
ENSDART00000145153 Essential Splice Site 444 747 11 16
Genomic Location:
Chromosome 6 (position 40871751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAACAAGCCTACAACAAACAGGCTCATGAWAAGATGTTTCGTAACAGG[T/G]AATTTTGATTATCCAAGATTAAAGCAGGTCACTGGTGTTATAATAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002728 Nonsense 484 747 13 16
ENSDART00000123022 Nonsense 681 944 15 18
ENSDART00000133599 Nonsense 681 944 16 19
ENSDART00000145153 Nonsense 484 747 13 16
Genomic Location:
Chromosome 6 (position 40873516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGTTGTCTCCATCCTTCACTCCCACCTCTGTRATCAAAAAAATGTA[T/A]GAGTCAAAAGAGAAAAGTCGGGATGATCTTGGGAGTAGACCAGGAAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oni1isat