cct3

Ensembl ID:
ENSDARG00000016173
ZFIN ID:
ZDB-GENE-020419-5
Description:
T-complex protein 1 subunit gamma [Source:RefSeq peptide;Acc:NP_775357]
Human Orthologue:
CCT3
Human Description:
chaperonin containing TCP1, subunit 3 (gamma) [Source:HGNC Symbol;Acc:1616]
Mouse Orthologue:
Cct3
Mouse Description:
chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1761 Essential Splice Site Available for shipment Available now
sa28686 Missense Mutation detected in F1 DNA During 2015
sa30547 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa1761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003752 Essential Splice Site 47 543 3 14

The following transcripts of ENSDARG00000016173 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 32723902)
KASP Assay ID:
554-1754.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATAGCAGACATCATCAGGACATGCCTAGGACCAAGGGCTATGATGAAG[G/A]TGCGCTTAAGATGTTCACGTTATCATTTTCCCAAGTGAATCTTTGTTATA
Associated Phenotype:
Data not yet available

Mutation Details

Allele Name:
sa28686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003752 Missense 56 543 4 14

The following transcripts of ENSDARG00000016173 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 32723796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAAAAATATGTTTTGTCTGCAGATGCTGCTGGATCCCATGGGTGGTA[T/A]CGTCATGACCAATGATGGCAATGCCATTTTGAGAGAGGTGATTTGAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003752 Nonsense 197 543 7 14

The following transcripts of ENSDARG00000016173 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 32722737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTTGAGCTGGAGGAAAATGGACGCAAAGAGATTGACATTAAGAAGTA[T/A]GCCAAAGTTGAAAAGGTAGGTTATGGCCAAGAGGATTTTCTGTTGTTACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qukwkzgt