cct3

Ensembl ID:
ENSDARG00000016173
ZFIN ID:
ZDB-GENE-020419-5
Description:
T-complex protein 1 subunit gamma [Source:RefSeq peptide;Acc:NP_775357]
Human Orthologue:
CCT3
Human Description:
chaperonin containing TCP1, subunit 3 (gamma) [Source:HGNC Symbol;Acc:1616]
Mouse Orthologue:
Cct3
Mouse Description:
chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1761 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003752 Essential Splice Site 47 543 3 14

The following transcripts of ENSDARG00000016173 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 32723902)
KASP Assay ID:
554-1754.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATAGCAGACATCATCAGGACATGCCTAGGACCAAGGGCTATGATGAAG[G/A]TGCGCTTAAGATGTTCACGTTATCATTTTCCCAAGTGAATCTTTGTTATA
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qukwkzgt