usp33

Ensembl ID:
ENSDARG00000016163
ZFIN ID:
ZDB-GENE-040426-2323
Description:
Ubiquitin carboxyl-terminal hydrolase 33 [Source:UniProtKB/Swiss-Prot;Acc:A5PMR2]
Human Orthologue:
USP33
Human Description:
ubiquitin specific peptidase 33 [Source:HGNC Symbol;Acc:20059]
Mouse Orthologue:
Usp33
Mouse Description:
ubiquitin specific peptidase 33 Gene [Source:MGI Symbol;Acc:MGI:2159711]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19677 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11270 Nonsense Available for shipment Available now
sa377 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018114 Essential Splice Site 539 897 15 24
ENSDART00000133037 None None 77 None 4
ENSDART00000137872 None None 59 None 4
Genomic Location:
Chromosome 2 (position 8532437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCATATTAGTTATACAATTCTTACATGGATTTTTTTTATTCTTTAACA[G/A]GAGACAACATGTACAGCTGTGAAAAATGCAAGAAGTACGTACAAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018114 Nonsense 563 897 16 24
ENSDART00000133037 None None 77 None 4
ENSDART00000137872 None None 59 None 4
Genomic Location:
Chromosome 2 (position 8532593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGTTTCAGATTACGGAATGGGGTCAAATTCTGCAAAGTTCAGAGTT[T/A]GCCAGAGGTAAGCATACAGAGGAGCTTTTCTGGTTATTATTAGKRGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018114 Essential Splice Site 668 897 18 24
ENSDART00000133037 None None 77 None 4
ENSDART00000137872 None None 59 None 4
Genomic Location:
Chromosome 2 (position 8540343)
KASP Assay ID:
554-0357.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGAGTCCTGTGTTCAAAACGCTGAGGCATATGTGCTCTTTTACAAG[T/C]GAGAACACACACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/96rb004c