dag1

Ensembl ID:
ENSDARG00000016153
ZFIN ID:
ZDB-GENE-021223-1
Description:
dystroglycan [Source:RefSeq peptide;Acc:NP_775381]
Human Orthologue:
DAG1
Human Description:
dystroglycan 1 (dystrophin-associated glycoprotein 1) [Source:HGNC Symbol;Acc:2666]
Mouse Orthologue:
Dag1
Mouse Description:
dystroglycan 1 Gene [Source:MGI Symbol;Acc:MGI:101864]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11376 Nonsense Available for shipment Available now
hu3072 Nonsense Confirmed mutation in F2 line Unknown
sa8855 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 278 866 3 3
ENSDART00000126885 Nonsense 278 866 2 2
Genomic Location:
Chromosome 22 (position 36070786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTGAAAACGGAGCTCTTTTGTCCTGGAAGCTCGGCTGCAGTCTGGAT[C/T]AAAGCAGCATTCCTGACATTAGCAGTGTTCAGGTTCCAGCAAAAGAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3072
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 398 866 3 3
ENSDART00000126885 Nonsense 398 866 2 2
Genomic Location:
Chromosome 22 (position 36071146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGATTCCGCGCCCTCCACTCCAACCTTAGGCCCCCCTCTGCCAACA[C/T]GAGTAATGGTCACCACCAGCACTATCGCCATCCAGCCAACAATGACCAGG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
skeletal muscle
ZFA:0005277
degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
12:37046024-37046700 37046024 -1 3.05 × 10-05 1.9 -1 socs3b ENSDARG00000026611
4:9193301-9194417 9194417 1 1.53 × 10-03 1.0 1 flncb ENSDARG00000018820
19:1977101-1977300 1975674 -1 3.96 × 10-03 0.9 4 rplp1 ENSDARG00000021864
3:26908018-26908900 26908018 -1 9.07 × 10-03 1.5 -2 hsp70l ENSDARG00000021924
22:24257101-24257365 24257365 1 0.02 -3.1 7 cfh ENSDARG00000075761

Mutation Details

Allele Name:
sa8855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 537 866 3 3
ENSDART00000126885 Nonsense 537 866 2 2
Genomic Location:
Chromosome 22 (position 36071563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCKGATGATTCCTGGATACAGTTTAATAGCACAAGCCAGTTACTGTAT[G/T]GATTACCTGACCAAGAGCATGCAGGGAAACAWGAGTATTTCATGCAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yt555543