xiap

Ensembl ID:
ENSDARG00000016143
ZFIN ID:
ZDB-GENE-030825-7
Description:
baculoviral IAP repeat-containing protein 4 [Source:RefSeq peptide;Acc:NP_919377]
Human Orthologues:
BIRC8, XIAP
Human Descriptions:
baculoviral IAP repeat-containing 8 [Source:HGNC Symbol;Acc:14878]
X-linked inhibitor of apoptosis [Source:HGNC Symbol;Acc:592]
Mouse Orthologue:
Xiap
Mouse Description:
X-linked inhibitor of apoptosis Gene [Source:MGI Symbol;Acc:MGI:107572]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017075 Nonsense 398 405 6 6
Genomic Location:
Chromosome 14 (position 29502967)
KASP Assay ID:
554-2600.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTCAGCGTCYCTAGACAAGTGTCCCATCTGCTGTGCTACCATCACA[C/T]AGAAGATAAAGACTTACAATGCCTAAATGACAAAGAARCCCGCCTTCTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3kpb8e45