LOC565776

Ensembl ID:
ENSDARG00000016141
Human Orthologue:
SLC6A2
Human Description:
solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc6a2
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13869 Nonsense Available for shipment Available now
sa21005 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012580 Nonsense 562 637 12 14
Genomic Location:
Chromosome 7 (position 36809467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTTTTCTGTGCAGTTAGTGGTGATCGCCAGCATTGTTACCTCCGGA[C/T]GACTGACATATGATGAATATGTTTTCCCAYACTGGGCAGATATGCTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012580 Essential Splice Site 630 637 13 14
Genomic Location:
Chromosome 7 (position 36806641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACATGAACATCACTTGGTGGCGGAGGGCAATGTCAGACAGTTCAAGG[T/C]AAGACCTGGGTACAGTGTTAAAAGTCTCAATATATCTATGCAATCTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mwnay391