mkks

Ensembl ID:
ENSDARG00000016139
ZFIN ID:
ZDB-GENE-040426-757
Description:
McKusick-Kaufman/Bardet-Biedl syndromes putative chaperonin [Source:RefSeq peptide;Acc:NP_956459]
Human Orthologue:
MKKS
Human Description:
McKusick-Kaufman syndrome [Source:HGNC Symbol;Acc:7108]
Mouse Orthologue:
Mkks
Mouse Description:
McKusick-Kaufman syndrome protein Gene [Source:MGI Symbol;Acc:MGI:1891836]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9366 Nonsense Mutation detected in F1 DNA During 2014
sa22346 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011583 Nonsense 58 563 2 5
Genomic Location:
Chromosome 13 (position 35696002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTGAAACAAATACACAACAACGTTGGGGGCCACGTCTTRACAACTT[C/A]AACCTCAACAGCGCTTCTYAAACGAMTAGAAATGTCTGAGCCGCTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011583 Nonsense 224 563 2 5
Genomic Location:
Chromosome 13 (position 35696499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGTGAACCATTCTTCAGTTTTTCCTGGACTGCTGCTGGATGTTCCT[G/T]AGATGCTCCTGCCTGGAGATCTCGAAAGACTGGGAGATGGTCCGTTTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/my2ixmmo