nme6

Ensembl ID:
ENSDARG00000016138
ZFIN ID:
ZDB-GENE-000710-3
Description:
Nucleoside diphosphate kinase 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6DI51]
Human Orthologue:
NME6
Human Description:
non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Nme6
Mouse Description:
non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43411 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103798 Essential Splice Site 59 175 2 5
Genomic Location (Zv9):
Chromosome 20 (position 19638772)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19667029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATATGGCGAAAAGCTGATTCGGAAATGTTTTATGCTGAACATTCAG[G/A]TAAAAACTGACTTCTTTATTTTATGAAACACTGGATGAATGAAAACGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link