keap1a

Ensembl ID:
ENSDARG00000016132
ZFIN ID:
ZDB-GENE-030131-556
Description:
kelch-like ECH-associated protein 1a [Source:RefSeq peptide;Acc:NP_878284]
Human Orthologue:
KEAP1
Human Description:
kelch-like ECH-associated protein 1 [Source:HGNC Symbol;Acc:23177]
Mouse Orthologue:
Keap1
Mouse Description:
kelch-like ECH-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858732]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12803 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045763 Nonsense 107 601 3 7
Genomic Location:
Chromosome 2 (position 41950204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCAAGGAGTGCCACGCGTCGGAAGTCACCCTTCGAGACGTTTGTCCT[C/T]AAGTCATCAGCCGTCTCWTTGACTTTGCCTAYACCTCGCGCAKCACAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/byzroobu