si:ch73-38f1.1

Ensembl ID:
ENSDARG00000016116
ZFIN ID:
ZDB-GENE-081028-51
Description:
Novel protein similar to vertebrate early B-cell factor 3 (EBF3) [Source:UniProtKB/TrEMBL;Acc:B8JKJ0
Human Orthologue:
EBF1
Human Description:
early B-cell factor 1 [Source:HGNC Symbol;Acc:3126]
Mouse Orthologue:
Ebf1
Mouse Description:
early B-cell factor 1 Gene [Source:MGI Symbol;Acc:MGI:95275]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35725 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35726 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006698 Essential Splice Site 45 591 2 17
ENSDART00000134114   None 335 None 8
Genomic Location (Zv9):
Chromosome 14 (position 36183736)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34685064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAAATACATCCATCATCATTCTGTCTGTCTTTCTTCTGTGTGTTTAT[A/T]GTGGAGTGGGTCTTGCTCGAGCACACTTTGAGAAGCAACCTCCTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006698 Nonsense 263 591 9 17
ENSDART00000134114 Nonsense 82 335 3 8
Genomic Location (Zv9):
Chromosome 14 (position 36342979)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34844307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCTCTGTCTGACTCTTTTCTTTTGCTCTTTCTAACAGCTACTCCTTG[C/A]ATTAAGGCCATCAGTCCCAGTGAAGGCTGGACGACAGGGGGTGCAACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link