qtrtd1

Ensembl ID:
ENSDARG00000016093
ZFIN ID:
ZDB-GENE-060427-4
Description:
Queuine tRNA-ribosyltransferase subunit qtrtd1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVJ6]
Human Orthologue:
QTRTD1
Human Description:
queuine tRNA-ribosyltransferase domain containing 1 [Source:HGNC Symbol;Acc:25771]
Mouse Orthologue:
Qtrtd1
Mouse Description:
queuine tRNA-ribosyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1922194]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14441 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020931 Nonsense 201 417 5 8
ENSDART00000129085 Nonsense 200 421 5 9
ENSDART00000136507   None 197 None 6
ENSDART00000140786 Nonsense 200 416 6 9
Genomic Location (Zv9):
Chromosome 24 (position 21681708)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20928837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAACATGCTGAGATATTTGGGGTTGTGGAAGGKGGAGATATTTTGGAA[G/T]AGAGGCTCCGCTCAGCACGRGAGACTGCTAAGCGTCCTGTGGGTGGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link