fibp

Ensembl ID:
ENSDARG00000016058
ZFIN ID:
ZDB-GENE-040426-1363
Description:
fibroblast growth factor (acidic) intracellular binding protein [Source:RefSeq peptide;Acc:NP_95670
Human Orthologue:
FIBP
Human Description:
fibroblast growth factor (acidic) intracellular binding protein [Source:HGNC Symbol;Acc:3705]
Mouse Orthologue:
Fibp
Mouse Description:
fibroblast growth factor (acidic) intracellular binding protein Gene [Source:MGI Symbol;Acc:MGI:1926

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22501 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020936 None None 357 1 11
ENSDART00000133126 Essential Splice Site None 357 None 12
Genomic Location:
Chromosome 14 (position 31593667)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGCAGCCATTTAACTTACATGCTAGTTAGTACTGCTTGACCAACAG[T/G]ATGCAAGCTTAACTTACCTATCCGACAAGCTTATGTTTTCGAGTGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020936 Nonsense 160 357 5 11
ENSDART00000133126 Nonsense 160 357 6 12
Genomic Location:
Chromosome 14 (position 31589523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTTTAAAGTGGTGGAAGAACTTAAGGGCCCCCTGGTGGAAAATATA[C/T]GACAGCACTTTCTGCTAYCTGATCAGTTAGCCAGGTGAGATTGTCWAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3st5fyz5