agpat9

Ensembl ID:
ENSDARG00000016048
ZFIN ID:
ZDB-GENE-040718-436
Description:
Glycerol-3-phosphate acyltransferase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6DG38]
Human Orthologue:
AGPAT9
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 9 [Source:HGNC Symbol;Acc:28157]
Mouse Orthologue:
Agpat9
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:3603816]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45734 Essential Splice Site Mutation detected in F1 DNA During 2018
sa3111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008389 Essential Splice Site None 449 2 13
ENSDART00000113997   None 450 None 12
ENSDART00000141596 Essential Splice Site None 450 2 13
Genomic Location (Zv9):
Chromosome 21 (position 18129791)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19278043
GRCz11 21 19314679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTACATTTGATTACATCATTGTCCTCTGTTTTGGCTTCTTGCTTTAA[G/A]GACTTGTTCAGATGGCCGGCCCCATAGACTGACAGGCAGACAGACGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008389 Nonsense 361 449 11 13
ENSDART00000113997 Nonsense 362 450 10 12
ENSDART00000141596 Nonsense 362 450 11 13
Genomic Location (Zv9):
Chromosome 21 (position 18119887)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19268139
GRCz11 21 19304775
KASP Assay ID:
554-2523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTTGGAGATGCCTTCTGGAACAGTGCCAAATACAACATGGTGAGCTA[C/A]ATCCTCAGAATGATGACAAGCTGGGCCATTGTGTGCAACGTGTGGTACCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link