ptplad1

Ensembl ID:
ENSDARG00000016038
ZFIN ID:
ZDB-GENE-040426-1200
Description:
3-hydroxyacyl-CoA dehydratase [Source:UniProtKB/Swiss-Prot;Acc:Q7SY06]
Human Orthologue:
PTPLAD1
Human Description:
protein tyrosine phosphatase-like A domain containing 1 [Source:HGNC Symbol;Acc:24175]
Mouse Orthologue:
Ptplad1
Mouse Description:
protein tyrosine phosphatase-like A domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1889341]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39197 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006300 Essential Splice Site 174 359 6 11
Genomic Location (Zv9):
Chromosome 18 (position 18767774)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18997997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGGATCTTCGTCAACATGACTGTACGTCTGTTCATTCTTGGACAAG[G/A]TTAGTCTGTTTTTTATTTTTTATTTTGTGTTATAATTTGCAAGCAGGTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link