ddx54

Ensembl ID:
ENSDARG00000016015
ZFIN IDs:
ZDB-GENE-021220-2, ZDB-GENE-021220-2, ZDB-GENE-050706-47
Description:
ATP-dependent RNA helicase DDX54 [Source:RefSeq peptide;Acc:NP_775375]
Human Orthologue:
DDX54
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 [Source:HGNC Symbol;Acc:20084]
Mouse Orthologue:
Ddx54
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Gene [Source:MGI Symbol;Acc:MGI:1919240]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26641 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026416 Essential Splice Site 41 862 1 21
ENSDART00000073797 Essential Splice Site 41 463 1 19
ENSDART00000128587 Essential Splice Site 41 862 1 20
Genomic Location (Zv9):
Chromosome 5 (position 75309067)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71410208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGAAGAGTTTGAGGTGGCCGCAGGAGTCAAAGATGACGAAAATACCG[T/C]GAGTTTCACACGCTTTCTGTCGGAGAGTCACCGATTATGTGTGTGTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link