gpcpd1

Ensembl ID:
ENSDARG00000016011
ZFIN ID:
ZDB-GENE-060503-472
Description:
preimplantation protein 4-like [Source:RefSeq peptide;Acc:NP_001103993]
Human Orthologue:
GPCPD1
Human Description:
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26957]
Mouse Orthologue:
Gpcpd1
Mouse Description:
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12862 Nonsense Available for shipment Available now
sa13354 Nonsense Available for shipment Available now
sa23800 Nonsense Mutation detected in F1 DNA During 2014
sa23799 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 49 666 4 20
ENSDART00000124283 Nonsense 49 666 3 19
Genomic Location:
Chromosome 20 (position 45908587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAYCTCCTGTGTTTTGCTCACATGCCYTCTCTCACCTCCCAGCACCT[T/A]ATGGAGAACAACCATTCACGTTCCTAGAGGAGCTGAAACCAAAWATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 375 666 12 20
ENSDART00000124283 Nonsense 375 666 11 19
Genomic Location:
Chromosome 20 (position 45888387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGTCTAAAGATTTAGTTCCWGTCGTTTACCACGATCTCACTTGCTG[T/A]ATTTCTACTAAAAAGGTAACACATTGTTTGCTGGAGTCAATGTTAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 388 666 13 20
ENSDART00000124283 Nonsense 388 666 12 19
Genomic Location:
Chromosome 20 (position 45884874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTCTGGTCTTGTTCGCTTTCCTAGAAAAATGACAAGACTTCAATGT[T/A]GTTGTTCGAAGTTCCTGTCAAAGATCTTACATTTGATCAACTTCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 515 666 18 20
ENSDART00000124283 Nonsense 515 666 17 19
Genomic Location:
Chromosome 20 (position 45880101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAAAAAATGTGTGTTTTCTACAGGGTGAGGCAGAAACAGAACAAATA[T/A]CCGATCCTGTTTCTGACCCAAGGAGTGACACAGCTCTATCCTGAGCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jq3v1tsm